Results 1 to 8 of 8

Finding every occurance of a string

Threaded View

  1. #1
    Registered User
    Join Date
    01-09-2015
    Location
    Reseda, CA
    MS-Off Ver
    MSOffice 365
    Posts
    23

    Finding every occurance of a string

    We are doing DNA research. We need to find all starting positions of a discreet string of characters within a larger string of characters. Below is a sample source string. Using FIND, we note that the first instance of TATAA from the left is at character 286. I think we can use the AGGREGATE formula (15 Small and 6 Ignore hidden values) to present all instances but I can't make it work. The ideal result would actually display the results from the right end of the source string. A result might be 6, 50, 75 (though that is not the case below). It doesn't matter if the list of occurences is presented in a column or row.

    If you find a great answer, then you will be helping figure out one of the great mysteries of life.

    Sample string (in cell B9)
    GGGAGTGTTATTTTAATAAAATTGCTAGTTATTGTTGTAACGCATTCGTCTTATTCGAATCAAAACGACAATTTCTTCCTACTCAGTGTACATACATGAAAAAAATAACTGTTTAATACACGAAGGAAACACATTAACAATTCTGTTGCGAAAAATATAGCGTTGTAAATTTTGACATACGCTTATTTTTTAAAATAAGAAAGACGATTTCTCTATTTTTCTTGATATTTATCCTTCCGCAATTGTCGTGACAATTTGTTCTCTCCTCTTCTTCAAGGCAACGATTATAACACAGTTATTTGAATATCACTCAAGTGTAACGGTTTCGAGCTCTTCGATATTTTCACGTAGCACGCGCCTGTGATGTTCTAGTTCTTAGAAAAACATATAATAACGGAAAAACGTCTCACCTTTCGTTGTTCCGTTTTTCTGAATCTGTACTCGACACCCTGTACACCTTCATTACTTTCAATGCAATTCGGTTGTTCATACCAATATCACATTTCATATGGACTCTTATATGTCAACGATTTAGCGTAAAAGCATTATTCACTGCACTTCTGATGACGATGCGCGAATTAAATCTATAACAAACGTTGCATCAAAAACGTTGAGTTAAACAAAATATCGCGCAATTGAGACATAAACAAAAAAAAAACGAGATATTTTTGTCCATTTATTACGAAAGTAACTCGCGATGTTCTTCCGTCATTTGTAAGACAAGACATGTAATAATTTTTCTCTTACTGTTCGTGTGCGATATGAGCGCAACTGTGGAGTTAGATAGGTAGCGATGTACAAAACGTAACCATATAGTTTCTTGGTCAGAACAATTTGACACAATAGAGCACTTCTCCGCATTTTGCACTAATGCGTGCGTAAAGACGGGTTGACAAGCGGGTATACGTCCCGAGCTGAATAAAAAATAGATCCTGATACTTGCGTCGCGTCGACGTAGCGAGAGCGGGATCGGTTATTGACGACAGCTAGTAGTTAGTCA
    Last edited by WilliamWelch; 06-12-2019 at 07:35 PM.

Thread Information

Users Browsing this Thread

There are currently 1 users browsing this thread. (0 members and 1 guests)

Similar Threads

  1. [SOLVED] Finding Max Occurance Based on Criteria
    By Butcher1 in forum Excel Formulas & Functions
    Replies: 2
    Last Post: 11-26-2014, 08:07 AM
  2. Finding last occurance in a row range
    By JoshExcel in forum Excel Formulas & Functions
    Replies: 5
    Last Post: 11-12-2013, 09:24 PM
  3. Finding the last occurance of a value in a matrix
    By Ayjay in forum Excel General
    Replies: 1
    Last Post: 07-15-2011, 02:27 AM
  4. Finding the Nth Occurance in a Match Function
    By kakron21 in forum Excel Programming / VBA / Macros
    Replies: 4
    Last Post: 05-09-2011, 05:48 AM
  5. Finding the first and last occurance of a value
    By Jonathan78 in forum Excel General
    Replies: 4
    Last Post: 02-13-2011, 06:22 AM
  6. Finding last occurance as Non-array formula?
    By ratboy505 in forum Excel Formulas & Functions
    Replies: 1
    Last Post: 03-12-2007, 05:45 PM
  7. finding occurance of characters
    By easwara@gmail.com in forum Excel General
    Replies: 4
    Last Post: 04-17-2006, 06:45 AM

Tags for this Thread

Bookmarks

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts

Search Engine Friendly URLs by vBSEO 3.6.0 RC 1